Information for 1-YCHGGACWHY (Motif 1)


Reverse Opposite:

p-value:1e-79
log p-value:-1.832e+02
Information Content per bp:1.571
Number of Target Sequences with motif527.0
Percentage of Target Sequences with motif23.07%
Number of Background Sequences with motif3759.9
Percentage of Background Sequences with motif9.57%
Average Position of motif in Targets25.6 +/- 11.1bp
Average Position of motif in Background25.9 +/- 19.6bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.11
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-198 MIMAT0000228 Homo sapiens miR-198 Targets (miRBase)

Match Rank:1
Score:0.68
Offset:-14
Orientation:forward strand
Alignment:--------------YCHGGACWHY
GAACCTATCTCCCCTCTGGACC--

hsa-miR-4669 MIMAT0019749 Homo sapiens miR-4669 Targets (miRBase)

Match Rank:2
Score:0.67
Offset:-12
Orientation:forward strand
Alignment:------------YCHGGACWHY
CCTCCTCCACTTCCCGGACACA

hsa-miR-4540 MIMAT0019083 Homo sapiens miR-4540 Targets (miRBase)

Match Rank:3
Score:0.67
Offset:-11
Orientation:forward strand
Alignment:-----------YCHGGACWHY
TAAACCTACAGGCAGGACTAA

hsa-miR-1289 MIMAT0005879 Homo sapiens miR-1289 Targets (miRBase)

Match Rank:4
Score:0.67
Offset:-12
Orientation:forward strand
Alignment:------------YCHGGACWHY-
AAAATGCAGATTCCTGGACTCCA

hsa-miR-554 MIMAT0003217 Homo sapiens miR-554 Targets (miRBase)

Match Rank:5
Score:0.67
Offset:-10
Orientation:forward strand
Alignment:----------YCHGGACWHY-
ACTGGCTGAGTCAGGACTAGC

hsa-miR-2355-3p MIMAT0017950 Homo sapiens miR-2355-3p Targets (miRBase)

Match Rank:6
Score:0.66
Offset:-12
Orientation:forward strand
Alignment:------------YCHGGACWHY
ATCTCCAAACAGCAAGGACAAT

hsa-miR-2964a-5p MIMAT0019747 Homo sapiens miR-2964a-5p Targets (miRBase)

Match Rank:7
Score:0.66
Offset:-11
Orientation:forward strand
Alignment:-----------YCHGGACWHY-
CGAGAATTGTGGCTGGACATCT

hsa-miR-1910 MIMAT0007884 Homo sapiens miR-1910 Targets (miRBase)

Match Rank:8
Score:0.64
Offset:-11
Orientation:forward strand
Alignment:-----------YCHGGACWHY
AGGCGGCAGGCACAGGACTGG

hsa-miR-455-3p MIMAT0004784 Homo sapiens miR-455-3p Targets (miRBase)

Match Rank:9
Score:0.64
Offset:-11
Orientation:forward strand
Alignment:-----------YCHGGACWHY
GTGTATATGCCCATGGACTGC

hsa-miR-676 MIMAT0018204 Homo sapiens miR-676 Targets (miRBase)

Match Rank:10
Score:0.64
Offset:-12
Orientation:forward strand
Alignment:------------YCHGGACWHY
AACTCAACAACCTTAGGACAG-