Information for 9-AAACTCATAC (Motif 10)


Reverse Opposite:

p-value:1e-9
log p-value:-2.170e+01
Information Content per bp:1.846
Number of Target Sequences with motif13.0
Percentage of Target Sequences with motif0.57%
Number of Background Sequences with motif20.2
Percentage of Background Sequences with motif0.05%
Average Position of motif in Targets29.5 +/- 10.2bp
Average Position of motif in Background25.7 +/- 7.9bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.00
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-4682 MIMAT0019767 Homo sapiens miR-4682 Targets (miRBase)

Match Rank:1
Score:0.65
Offset:-14
Orientation:forward strand
Alignment:--------------AAACTCATAC
AGACCAGGCTCCAGGAACTCAGA-

hsa-miR-3115 MIMAT0014977 Homo sapiens miR-3115 Targets (miRBase)

Match Rank:2
Score:0.64
Offset:-10
Orientation:forward strand
Alignment:----------AAACTCATAC
ACCAACTAGTAAACCCATAT

hsa-miR-627 MIMAT0003296 Homo sapiens miR-627 Targets (miRBase)

Match Rank:3
Score:0.63
Offset:-14
Orientation:forward strand
Alignment:--------------AAACTCATAC
TCCTCTTTTCTTAGAGACTCAC--

hsa-miR-4658 MIMAT0019725 Homo sapiens miR-4658 Targets (miRBase)

Match Rank:4
Score:0.63
Offset:-15
Orientation:forward strand
Alignment:---------------AAACTCATAC
ATTCCTCCAGGATCCACACTCAC--

hsa-miR-3659 MIMAT0018080 Homo sapiens miR-3659 Targets (miRBase)

Match Rank:5
Score:0.58
Offset:-14
Orientation:forward strand
Alignment:--------------AAACTCATAC
TGCCCTCGTAGACAACACTCA---

hsa-miR-223 MIMAT0000280 Homo sapiens miR-223 Targets (miRBase)

Match Rank:6
Score:0.57
Offset:-13
Orientation:forward strand
Alignment:-------------AAACTCATAC
TGGGGTATTTGACAAACTGACA-

hsa-miR-574-5p MIMAT0004795 Homo sapiens miR-574-5p Targets (miRBase)

Match Rank:7
Score:0.57
Offset:-16
Orientation:forward strand
Alignment:----------------AAACTCATAC
ACACACTCACACACACACACTCA---

hsa-miR-496 MIMAT0002818 Homo sapiens miR-496 Targets (miRBase)

Match Rank:8
Score:0.56
Offset:-15
Orientation:forward strand
Alignment:---------------AAACTCATAC
GAGATTGGCCATGTAATACTCA---

hsa-miR-3164 MIMAT0015038 Homo sapiens miR-3164 Targets (miRBase)

Match Rank:9
Score:0.55
Offset:-13
Orientation:forward strand
Alignment:-------------AAACTCATAC
CGCCATTTCCCTTAAAGTCACA-

hsa-miR-1294 MIMAT0005884 Homo sapiens miR-1294 Targets (miRBase)

Match Rank:10
Score:0.55
Offset:-13
Orientation:forward strand
Alignment:-------------AAACTCATAC
AGACAACAATGCCAACCTCACA-