Information for 10-ATCGTTCC (Motif 11)


Reverse Opposite:

p-value:1e-6
log p-value:-1.461e+01
Information Content per bp:1.956
Number of Target Sequences with motif4.0
Percentage of Target Sequences with motif0.18%
Number of Background Sequences with motif1.3
Percentage of Background Sequences with motif0.00%
Average Position of motif in Targets28.2 +/- 12.5bp
Average Position of motif in Background20.4 +/- 7.2bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.00
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-29c* MIMAT0004673 Homo sapiens miR-29c* Targets (miRBase)

Match Rank:1
Score:0.66
Offset:-14
Orientation:forward strand
Alignment:--------------ATCGTTCC
GAACACCAGGAGAAATCGGTCA

hsa-miR-1292 MIMAT0005943 Homo sapiens miR-1292 Targets (miRBase)

Match Rank:2
Score:0.63
Offset:-15
Orientation:forward strand
Alignment:---------------ATCGTTCC--
CAGCGTCTGCCGGAACCCGTTCCCA

hsa-miR-4533 MIMAT0019072 Homo sapiens miR-4533 Targets (miRBase)

Match Rank:3
Score:0.62
Offset:-13
Orientation:forward strand
Alignment:-------------ATCGTTCC-
AGCGTCCGGCAACCTCCTTCCA

hsa-miR-891a MIMAT0004902 Homo sapiens miR-891a Targets (miRBase)

Match Rank:4
Score:0.62
Offset:-13
Orientation:forward strand
Alignment:-------------ATCGTTCC-
TCAGTGGCTCAGGTTCGTTGCA

hsa-miR-4476 MIMAT0019003 Homo sapiens miR-4476 Targets (miRBase)

Match Rank:5
Score:0.61
Offset:-12
Orientation:forward strand
Alignment:------------ATCGTTCC--
GCCTGTCCCTAAATCCTTCCTG

hsa-miR-3928 MIMAT0018205 Homo sapiens miR-3928 Targets (miRBase)

Match Rank:6
Score:0.57
Offset:-11
Orientation:forward strand
Alignment:-----------ATCGTTCC---
GCCGAAGCTCCAAGGTTCCTCC

hsa-miR-4740-5p MIMAT0019869 Homo sapiens miR-4740-5p Targets (miRBase)

Match Rank:7
Score:0.56
Offset:-13
Orientation:forward strand
Alignment:-------------ATCGTTCC-
CCTGCCCGAGAGGATCAGTCCT

hsa-miR-4306 MIMAT0016858 Homo sapiens miR-4306 Targets (miRBase)

Match Rank:8
Score:0.56
Offset:-8
Orientation:forward strand
Alignment:--------ATCGTTCC-
TACTGCCTTTCTCTCCA

hsa-miR-4747-5p MIMAT0019882 Homo sapiens miR-4747-5p Targets (miRBase)

Match Rank:9
Score:0.55
Offset:-12
Orientation:forward strand
Alignment:------------ATCGTTCC--
CTAAGACCAAGCCTCCTTCCCT

hsa-miR-3914 MIMAT0018188 Homo sapiens miR-3914 Targets (miRBase)

Match Rank:10
Score:0.55
Offset:-12
Orientation:forward strand
Alignment:------------ATCGTTCC--
ACTTCTCATTTTCTGGTTCCTT