Information for 2-TGTAAATACT (Motif 2)


Reverse Opposite:

p-value:1e-22
log p-value:-5.067e+01
Information Content per bp:1.882
Number of Target Sequences with motif13.0
Percentage of Target Sequences with motif0.57%
Number of Background Sequences with motif2.4
Percentage of Background Sequences with motif0.01%
Average Position of motif in Targets20.6 +/- 9.4bp
Average Position of motif in Background24.8 +/- 4.8bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.08
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-16-1* MIMAT0004489 Homo sapiens miR-16-1* Targets (miRBase)

Match Rank:1
Score:0.64
Offset:-10
Orientation:forward strand
Alignment:----------TGTAAATACT--
TCAGCAGCACAGTTAATACTGG

hsa-miR-4699-3p MIMAT0019795 Homo sapiens miR-4699-3p Targets (miRBase)

Match Rank:2
Score:0.59
Offset:-14
Orientation:forward strand
Alignment:--------------TGTAAATACT
GGAGAAGATTGCAGAGTAAATT--

hsa-miR-548l MIMAT0005889 Homo sapiens miR-548l Targets (miRBase)

Match Rank:3
Score:0.57
Offset:-9
Orientation:forward strand
Alignment:---------TGTAAATACT---
GACAAAACCCGCAAATACTTTT

hsa-miR-514b-3p MIMAT0015088 Homo sapiens miR-514b-3p Targets (miRBase)

Match Rank:4
Score:0.56
Offset:-14
Orientation:forward strand
Alignment:--------------TGTAAATACT
TCCACTCACAGAGGTGTCAAT---

hsa-miR-514 MIMAT0002883 Homo sapiens miR-514 Targets (miRBase)

Match Rank:5
Score:0.56
Offset:-14
Orientation:forward strand
Alignment:--------------TGTAAATACT
TCTACTCACAGAAGTGTCAAT---

hsa-miR-3618 MIMAT0017998 Homo sapiens miR-3618 Targets (miRBase)

Match Rank:6
Score:0.54
Offset:-14
Orientation:forward strand
Alignment:--------------TGTAAATACT
GCTCTTTTCATTAATGTAGACA--

hsa-miR-4742-3p MIMAT0019873 Homo sapiens miR-4742-3p Targets (miRBase)

Match Rank:7
Score:0.53
Offset:-11
Orientation:forward strand
Alignment:-----------TGTAAATACT--
CTGCAGGCAAAGGAGAATACAGA

hsa-miR-600 MIMAT0003268 Homo sapiens miR-600 Targets (miRBase)

Match Rank:8
Score:0.53
Offset:-16
Orientation:forward strand
Alignment:----------------TGTAAATACT
GAGCAAGGCTCTTGTCTGTAAGT---

hsa-miR-223* MIMAT0004570 Homo sapiens miR-223* Targets (miRBase)

Match Rank:9
Score:0.53
Offset:-10
Orientation:forward strand
Alignment:----------TGTAAATACT--
AACTCAGCTTGTCAAATACACG

hsa-miR-124* MIMAT0004591 Homo sapiens miR-124* Targets (miRBase)

Match Rank:10
Score:0.53
Offset:-12
Orientation:forward strand
Alignment:------------TGTAAATACT
ATCAAGGTCCGCTGTGAACACG