Information for 3-CATCNWCANC (Motif 3)


Reverse Opposite:

p-value:1e-19
log p-value:-4.503e+01
Information Content per bp:1.575
Number of Target Sequences with motif263.0
Percentage of Target Sequences with motif11.51%
Number of Background Sequences with motif2490.2
Percentage of Background Sequences with motif6.34%
Average Position of motif in Targets25.0 +/- 10.9bp
Average Position of motif in Background24.7 +/- 21.1bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.08
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-3605-5p MIMAT0017981 Homo sapiens miR-3605-5p Targets (miRBase)

Match Rank:1
Score:0.61
Offset:-15
Orientation:forward strand
Alignment:---------------CATCNWCANC
GGCTTCCTTGCTATCCATCCTCA--

hsa-miR-3691-5p MIMAT0018120 Homo sapiens miR-3691-5p Targets (miRBase)

Match Rank:2
Score:0.61
Offset:-15
Orientation:forward strand
Alignment:---------------CATCNWCANC
GTACCGAGTCTCCATCATCCACT--

hsa-miR-1272 MIMAT0005925 Homo sapiens miR-1272 Targets (miRBase)

Match Rank:3
Score:0.60
Offset:-16
Orientation:forward strand
Alignment:----------------CATCNWCANC
TTTCAGAATTTGCTGCCATCATCATC

hsa-miR-3190 MIMAT0015073 Homo sapiens miR-3190 Targets (miRBase)

Match Rank:4
Score:0.59
Offset:-15
Orientation:forward strand
Alignment:---------------CATCNWCANC
TCTCTGGCCGTCTACCTTCCACA--

hsa-miR-4502 MIMAT0019038 Homo sapiens miR-4502 Targets (miRBase)

Match Rank:5
Score:0.59
Offset:-12
Orientation:forward strand
Alignment:------------CATCNWCANC
CTTCAGCACCATCATCATCAGC

hsa-miR-4703-3p MIMAT0019802 Homo sapiens miR-4703-3p Targets (miRBase)

Match Rank:6
Score:0.57
Offset:-14
Orientation:forward strand
Alignment:--------------CATCNWCANC
GTGGCAATACAATACAACTACA--

hsa-miR-4458 MIMAT0018980 Homo sapiens miR-4458 Targets (miRBase)

Match Rank:7
Score:0.57
Offset:-8
Orientation:forward strand
Alignment:--------CATCNWCANC-
TTCTTCCACACCTACCTCT

hsa-miR-4534 MIMAT0019073 Homo sapiens miR-4534 Targets (miRBase)

Match Rank:8
Score:0.56
Offset:-6
Orientation:forward strand
Alignment:------CATCNWCANC-
AGACCCCTCCTCCATCC

hsa-miR-4500 MIMAT0019036 Homo sapiens miR-4500 Targets (miRBase)

Match Rank:9
Score:0.56
Offset:-6
Orientation:forward strand
Alignment:------CATCNWCANC-
AAGAAACTACTACCTCA

hsa-miR-4764-5p MIMAT0019914 Homo sapiens miR-4764-5p Targets (miRBase)

Match Rank:10
Score:0.56
Offset:-9
Orientation:forward strand
Alignment:---------CATCNWCANC--
AGATAACTCCTTCCACATCCA