Information for 4-SACCTCTTCC (Motif 4)


Reverse Opposite:

p-value:1e-19
log p-value:-4.474e+01
Information Content per bp:1.605
Number of Target Sequences with motif170.0
Percentage of Target Sequences with motif7.44%
Number of Background Sequences with motif1349.5
Percentage of Background Sequences with motif3.43%
Average Position of motif in Targets24.5 +/- 11.1bp
Average Position of motif in Background25.3 +/- 19.7bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.04
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-4451 MIMAT0018973 Homo sapiens miR-4451 Targets (miRBase)

Match Rank:1
Score:0.70
Offset:-6
Orientation:forward strand
Alignment:------SACCTCTTCC-
TGTCCTCAGCTCTACCA

hsa-miR-3179 MIMAT0015056 Homo sapiens miR-3179 Targets (miRBase)

Match Rank:2
Score:0.70
Offset:-12
Orientation:forward strand
Alignment:------------SACCTCTTCC
ACGTTTAAATTTCACCCCTTCT

hsa-miR-4709-3p MIMAT0019812 Homo sapiens miR-4709-3p Targets (miRBase)

Match Rank:3
Score:0.64
Offset:-12
Orientation:forward strand
Alignment:------------SACCTCTTCC-
GCTACAGAGCACCTCCTCTTCAA

hsa-miR-765 MIMAT0003945 Homo sapiens miR-765 Targets (miRBase)

Match Rank:4
Score:0.62
Offset:-10
Orientation:forward strand
Alignment:----------SACCTCTTCC-
CATCACCTTCCTTCTCCTCCA

hsa-miR-4725-3p MIMAT0019844 Homo sapiens miR-4725-3p Targets (miRBase)

Match Rank:5
Score:0.61
Offset:-9
Orientation:forward strand
Alignment:---------SACCTCTTCC---
CCCGACACTGACGCCTTCCCCA

hsa-miR-3202 MIMAT0015089 Homo sapiens miR-3202 Targets (miRBase)

Match Rank:6
Score:0.60
Offset:-11
Orientation:forward strand
Alignment:-----------SACCTCTTCC-
ATTAAAGCTCTTCTCCCTTCCA

hsa-miR-3185 MIMAT0015065 Homo sapiens miR-3185 Targets (miRBase)

Match Rank:7
Score:0.60
Offset:-13
Orientation:forward strand
Alignment:-------------SACCTCTTCC
CCGCAGACCGACCGCCTTCTTCT

hsa-miR-3936 MIMAT0018351 Homo sapiens miR-3936 Targets (miRBase)

Match Rank:8
Score:0.60
Offset:-13
Orientation:forward strand
Alignment:-------------SACCTCTTCC
TGCATCTGCCATACACCCCTTA-

hsa-miR-2467-3p MIMAT0019953 Homo sapiens miR-2467-3p Targets (miRBase)

Match Rank:9
Score:0.60
Offset:-12
Orientation:forward strand
Alignment:------------SACCTCTTCC
CCTGAGCCTCTCTGCCTCTGCT

hsa-miR-4795-5p MIMAT0019968 Homo sapiens miR-4795-5p Targets (miRBase)

Match Rank:10
Score:0.60
Offset:-11
Orientation:forward strand
Alignment:-----------SACCTCTTCC
TCAATATTATTAGCCACTTCT