Information for 5-CTGACTTTTA (Motif 5)


Reverse Opposite:

p-value:1e-17
log p-value:-4.038e+01
Information Content per bp:1.659
Number of Target Sequences with motif106.0
Percentage of Target Sequences with motif4.64%
Number of Background Sequences with motif695.8
Percentage of Background Sequences with motif1.77%
Average Position of motif in Targets26.5 +/- 11.1bp
Average Position of motif in Background24.4 +/- 19.9bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.02
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-548an MIMAT0019079 Homo sapiens miR-548an Targets (miRBase)

Match Rank:1
Score:0.65
Offset:-11
Orientation:forward strand
Alignment:-----------CTGACTTTTA
CAAAAACCACAATGCCTTTT-

hsa-miR-548ah MIMAT0018972 Homo sapiens miR-548ah Targets (miRBase)

Match Rank:2
Score:0.65
Offset:-11
Orientation:forward strand
Alignment:-----------CTGACTTTTA
CAAACACTGCAATCACTTTT-

hsa-miR-132 MIMAT0000426 Homo sapiens miR-132 Targets (miRBase)

Match Rank:3
Score:0.63
Offset:-12
Orientation:forward strand
Alignment:------------CTGACTTTTA
CGACCATGGCTGTAGACTGTTA

hsa-miR-212 MIMAT0000269 Homo sapiens miR-212 Targets (miRBase)

Match Rank:4
Score:0.63
Offset:-11
Orientation:forward strand
Alignment:-----------CTGACTTTTA
GGCCGTGACTGGAGACTGTTA

hsa-miR-548ak MIMAT0019013 Homo sapiens miR-548ak Targets (miRBase)

Match Rank:5
Score:0.63
Offset:-12
Orientation:forward strand
Alignment:------------CTGACTTTTA
TCAAAAACCGCAGTTACTTTT-

hsa-miR-3974 MIMAT0019359 Homo sapiens miR-3974 Targets (miRBase)

Match Rank:6
Score:0.62
Offset:-14
Orientation:forward strand
Alignment:--------------CTGACTTTTA
GCATTAACCTTACAATGACCTTT-

hsa-miR-548t MIMAT0015009 Homo sapiens miR-548t Targets (miRBase)

Match Rank:7
Score:0.62
Offset:-11
Orientation:forward strand
Alignment:-----------CTGACTTTTA
CAAAAACCACGATCACTTTTG

hsa-miR-548c-5p MIMAT0004806 Homo sapiens miR-548c-5p Targets (miRBase)

Match Rank:8
Score:0.62
Offset:-13
Orientation:forward strand
Alignment:-------------CTGACTTTTA
GGCAAAAACCGCAATTACTTTT-

hsa-miR-548y MIMAT0018354 Homo sapiens miR-548y Targets (miRBase)

Match Rank:9
Score:0.62
Offset:-13
Orientation:forward strand
Alignment:-------------CTGACTTTTA
GGCAAAAACAGTGATTACTTTT-

hsa-miR-548b-5p MIMAT0004798 Homo sapiens miR-548b-5p Targets (miRBase)

Match Rank:10
Score:0.62
Offset:-13
Orientation:forward strand
Alignment:-------------CTGACTTTTA
GGCCAAAACCACAATTACTTTT-