Information for 6-CCGTCGTC (Motif 6)


Reverse Opposite:

p-value:1e-16
log p-value:-3.855e+01
Information Content per bp:1.797
Number of Target Sequences with motif34.0
Percentage of Target Sequences with motif1.49%
Number of Background Sequences with motif87.1
Percentage of Background Sequences with motif0.22%
Average Position of motif in Targets25.0 +/- 12.2bp
Average Position of motif in Background24.6 +/- 12.0bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.00
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-483-5p MIMAT0004761 Homo sapiens miR-483-5p Targets (miRBase)

Match Rank:1
Score:0.61
Offset:-15
Orientation:forward strand
Alignment:---------------CCGTCGTC
CTCCCTTCTTTCCTCCCGTCTT-

hsa-miR-4426 MIMAT0018941 Homo sapiens miR-4426 Targets (miRBase)

Match Rank:2
Score:0.59
Offset:-9
Orientation:forward strand
Alignment:---------CCGTCGTC
AAAGTACGTCCATCTTC

hsa-miR-3185 MIMAT0015065 Homo sapiens miR-3185 Targets (miRBase)

Match Rank:3
Score:0.57
Offset:-14
Orientation:forward strand
Alignment:--------------CCGTCGTC-
CCGCAGACCGACCGCCTTCTTCT

hsa-miR-4647 MIMAT0019709 Homo sapiens miR-4647 Targets (miRBase)

Match Rank:4
Score:0.56
Offset:-15
Orientation:forward strand
Alignment:---------------CCGTCGTC
TTCCTCAGCACAGCACCATCTTC

hsa-miR-591 MIMAT0003259 Homo sapiens miR-591 Targets (miRBase)

Match Rank:5
Score:0.56
Offset:-11
Orientation:forward strand
Alignment:-----------CCGTCGTC-
ACAATGAGAACCCATGGTCT

hsa-miR-3131 MIMAT0014996 Homo sapiens miR-3131 Targets (miRBase)

Match Rank:6
Score:0.56
Offset:-13
Orientation:forward strand
Alignment:-------------CCGTCGTC--
AAGGCCCTTCCACCAGTCCTCGA

hsa-miR-3605-5p MIMAT0017981 Homo sapiens miR-3605-5p Targets (miRBase)

Match Rank:7
Score:0.56
Offset:-14
Orientation:forward strand
Alignment:--------------CCGTCGTC-
GGCTTCCTTGCTATCCATCCTCA

hsa-miR-4467 MIMAT0018994 Homo sapiens miR-4467 Targets (miRBase)

Match Rank:8
Score:0.55
Offset:-13
Orientation:forward strand
Alignment:-------------CCGTCGTC-
AAGCCCATAACTACCGCCGCCA

hsa-miR-3141 MIMAT0015010 Homo sapiens miR-3141 Targets (miRBase)

Match Rank:9
Score:0.54
Offset:-11
Orientation:forward strand
Alignment:-----------CCGTCGTC
TCCTCCTCCACCCGCCCTC

hsa-miR-3960 MIMAT0019337 Homo sapiens miR-3960 Targets (miRBase)

Match Rank:10
Score:0.54
Offset:-12
Orientation:forward strand
Alignment:------------CCGTCGTC
CCCCCGCCTCCGCCGCCGCC