Information for 6-GGCCGGTACT (Motif 7)


Reverse Opposite:

p-value:1e-16
log p-value:-3.689e+01
Information Content per bp:1.871
Number of Target Sequences with motif11.0
Percentage of Target Sequences with motif0.48%
Number of Background Sequences with motif3.7
Percentage of Background Sequences with motif0.01%
Average Position of motif in Targets16.1 +/- 11.5bp
Average Position of motif in Background18.3 +/- 6.4bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.00
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-4485 MIMAT0019019 Homo sapiens miR-4485 Targets (miRBase)

Match Rank:1
Score:0.63
Offset:-12
Orientation:forward strand
Alignment:------------GGCCGGTACT
TTAGGGTACCGCGGCCGTTA--

hsa-miR-1911 MIMAT0007885 Homo sapiens miR-1911 Targets (miRBase)

Match Rank:2
Score:0.62
Offset:-11
Orientation:forward strand
Alignment:-----------GGCCGGTACT--
CCCAACAGACATGGCGGTACTCA

hsa-miR-371-3p MIMAT0000723 Homo sapiens miR-371-3p Targets (miRBase)

Match Rank:3
Score:0.59
Offset:-12
Orientation:forward strand
Alignment:------------GGCCGGTACT-
ACACTCAAAAGATGGCGGCACTT

hsa-miR-4712-5p MIMAT0019818 Homo sapiens miR-4712-5p Targets (miRBase)

Match Rank:4
Score:0.57
Offset:-9
Orientation:forward strand
Alignment:---------GGCCGGTACT---
GAAATGAGAGACCTGTACTGGA

hsa-miR-624* MIMAT0003293 Homo sapiens miR-624* Targets (miRBase)

Match Rank:5
Score:0.56
Offset:-11
Orientation:forward strand
Alignment:-----------GGCCGGTACT-
TGAACACAAGGTACTGGTACTA

hsa-miR-4747-3p MIMAT0019883 Homo sapiens miR-4747-3p Targets (miRBase)

Match Rank:6
Score:0.55
Offset:-11
Orientation:forward strand
Alignment:-----------GGCCGGTACT-
CTGGGAGGAAAGCCCGGGCCTT

hsa-miR-1278 MIMAT0005936 Homo sapiens miR-1278 Targets (miRBase)

Match Rank:7
Score:0.55
Offset:-11
Orientation:forward strand
Alignment:-----------GGCCGGTACT-
ATAGATGATATGCACAGTACTA

hsa-miR-1909* MIMAT0007882 Homo sapiens miR-1909* Targets (miRBase)

Match Rank:8
Score:0.55
Offset:-9
Orientation:forward strand
Alignment:---------GGCCGGTACT--
CAGGGCAGGCACCGGCACTCA

hsa-miR-193b MIMAT0002819 Homo sapiens miR-193b Targets (miRBase)

Match Rank:9
Score:0.54
Offset:-14
Orientation:forward strand
Alignment:--------------GGCCGGTACT
AGCGGGACTTTGAGGGCCAGTT--

hsa-miR-193a-3p MIMAT0000459 Homo sapiens miR-193a-3p Targets (miRBase)

Match Rank:10
Score:0.54
Offset:-14
Orientation:forward strand
Alignment:--------------GGCCGGTACT
ACTGGGACTTTGTAGGCCAGTT--