Information for 7-CTTAAAAACT (Motif 8)


Reverse Opposite:

p-value:1e-12
log p-value:-2.891e+01
Information Content per bp:1.660
Number of Target Sequences with motif72.0
Percentage of Target Sequences with motif3.15%
Number of Background Sequences with motif462.8
Percentage of Background Sequences with motif1.18%
Average Position of motif in Targets25.7 +/- 11.6bp
Average Position of motif in Background25.0 +/- 20.3bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.05
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-19b-2* MIMAT0004492 Homo sapiens miR-19b-2* Targets (miRBase)

Match Rank:1
Score:0.59
Offset:-12
Orientation:forward strand
Alignment:------------CTTAAAAACT
TGAAATGCAAACCTGCAAAACT

hsa-miR-4328 MIMAT0016926 Homo sapiens miR-4328 Targets (miRBase)

Match Rank:2
Score:0.58
Offset:-5
Orientation:forward strand
Alignment:-----CTTAAAAACT--
AATCCTGGGAAAACTGG

hsa-miR-19b-1* MIMAT0004491 Homo sapiens miR-19b-1* Targets (miRBase)

Match Rank:3
Score:0.58
Offset:-13
Orientation:forward strand
Alignment:-------------CTTAAAAACT
GCTGGATGCAAACCTGCAAAACT

hsa-miR-22* MIMAT0004495 Homo sapiens miR-22* Targets (miRBase)

Match Rank:4
Score:0.58
Offset:-12
Orientation:forward strand
Alignment:------------CTTAAAAACT
TAAAGCTTGCCACTGAAGAACT

hsa-miR-3168 MIMAT0015043 Homo sapiens miR-3168 Targets (miRBase)

Match Rank:5
Score:0.56
Offset:-6
Orientation:forward strand
Alignment:------CTTAAAAACT-
GTCTGACTGTAGAACTC

hsa-miR-627 MIMAT0003296 Homo sapiens miR-627 Targets (miRBase)

Match Rank:6
Score:0.55
Offset:-9
Orientation:forward strand
Alignment:---------CTTAAAAACT---
TCCTCTTTTCTTAGAGACTCAC

hsa-miR-2052 MIMAT0009977 Homo sapiens miR-2052 Targets (miRBase)

Match Rank:7
Score:0.55
Offset:-10
Orientation:forward strand
Alignment:----------CTTAAAAACT
ACATTACTGTTATCAAAACA

hsa-miR-4263 MIMAT0016898 Homo sapiens miR-4263 Targets (miRBase)

Match Rank:8
Score:0.55
Offset:-10
Orientation:forward strand
Alignment:----------CTTAAAAACT
GGCCAAGGCACTTAGAAT--

hsa-miR-4477a MIMAT0019004 Homo sapiens miR-4477a Targets (miRBase)

Match Rank:9
Score:0.55
Offset:-14
Orientation:forward strand
Alignment:--------------CTTAAAAACT
GAATCACAAATGTCCTTAATAG--

hsa-miR-3658 MIMAT0018078 Homo sapiens miR-3658 Targets (miRBase)

Match Rank:10
Score:0.54
Offset:-16
Orientation:forward strand
Alignment:----------------CTTAAAAACT
ATCTCCATGGTGTTTTCTTAAA----