Information for 8-GACTGARTAC (Motif 9)


Reverse Opposite:

p-value:1e-9
log p-value:-2.231e+01
Information Content per bp:1.802
Number of Target Sequences with motif13.0
Percentage of Target Sequences with motif0.57%
Number of Background Sequences with motif19.1
Percentage of Background Sequences with motif0.05%
Average Position of motif in Targets26.5 +/- 13.8bp
Average Position of motif in Background22.3 +/- 10.9bp
Strand Bias (log2 ratio + to - strand density)10.0
Multiplicity (# of sites on avg that occur together)1.00
Motif File:file (matrix)
reverse opposite
PDF Format Logos:forward logo
reverse opposite

Matches to Known Motifs

hsa-miR-4264 MIMAT0016899 Homo sapiens miR-4264 Targets (miRBase)

Match Rank:1
Score:0.76
Offset:-9
Orientation:forward strand
Alignment:---------GACTGARTAC
AATGACCATGACTGAGT--

hsa-miR-512-5p MIMAT0002822 Homo sapiens miR-512-5p Targets (miRBase)

Match Rank:2
Score:0.59
Offset:-14
Orientation:forward strand
Alignment:--------------GACTGARTAC
GAAAGTGCCCTCAAGGCTGAGTG-

hsa-miR-3130-5p MIMAT0014995 Homo sapiens miR-3130-5p Targets (miRBase)

Match Rank:3
Score:0.59
Offset:-12
Orientation:forward strand
Alignment:------------GACTGARTAC
GGCTGCACCGGAGACTGGGTA-

hsa-miR-4704-3p MIMAT0019804 Homo sapiens miR-4704-3p Targets (miRBase)

Match Rank:4
Score:0.59
Offset:-16
Orientation:forward strand
Alignment:----------------GACTGARTAC
TAGACACTAGATATGTGACTGA----

hsa-let-7f-2* MIMAT0004487 Homo sapiens let-7f-2* Targets (miRBase)

Match Rank:5
Score:0.58
Offset:-12
Orientation:forward strand
Alignment:------------GACTGARTAC
GGAAAGACAGTAGACTGTATAG

hsa-miR-510 MIMAT0002882 Homo sapiens miR-510 Targets (miRBase)

Match Rank:6
Score:0.58
Offset:-13
Orientation:forward strand
Alignment:-------------GACTGARTAC
GTGATTGCCACTCTCCTGAGTA-

hsa-miR-3157-5p MIMAT0015031 Homo sapiens miR-3157-5p Targets (miRBase)

Match Rank:7
Score:0.57
Offset:-15
Orientation:forward strand
Alignment:---------------GACTGARTAC
AGACTGCACTAGCCTGGCTGAA---

hsa-miR-30e* MIMAT0000693 Homo sapiens miR-30e* Targets (miRBase)

Match Rank:8
Score:0.56
Offset:-13
Orientation:forward strand
Alignment:-------------GACTGARTAC
GCTGTAAACATCCGACTGAAAG-

hsa-miR-30a* MIMAT0000088 Homo sapiens miR-30a* Targets (miRBase)

Match Rank:9
Score:0.56
Offset:-13
Orientation:forward strand
Alignment:-------------GACTGARTAC
GCTGCAAACATCCGACTGAAAG-

hsa-miR-30d* MIMAT0004551 Homo sapiens miR-30d* Targets (miRBase)

Match Rank:10
Score:0.56
Offset:-13
Orientation:forward strand
Alignment:-------------GACTGARTAC
GCAGCAAACATCTGACTGAAAG-