microRNA namehsa-miR-21-5p
mirAccessionMIMAT0000076
sequenceTAGCTTATCAGACTGATGTTGA

Cancer Type   
Chart Type   
x Axis:    Gene with Data Type



  1. miRBase: tools for microRNA genomics.
    Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. NAR, 36(Database Issue):D154-D158(2008).